PrimerBLAST 操作说明

1、GeXP Gene Expression Multiplex Design:Using NCBI Primer-BLAST to design high performance, gene-specific primers for an XP-PCR multiplexUpdated: March 07, 2011Use Accession Numbers or Proprietary Genes to create gene-specific primers for amplicons 105-350 nucleotides in lengthThe shotgun approach is

2、an efficient method to use when little or no genome information is available for the organism of interest. Little or no homology, pseudogene or transcript variant information No SNP information No intron/exon boundariesThe strategic approach is recommended when a model organism is used and/or there

3、is sufficient genomic data available in NCBI for Primer-BLAST to scan primers for: Homology and/or transcript variants SNP Intron/exon boundaries are known12Accession NumbersNCBI Primer-BLAST designPre-design considerationsOrder primers with universal tags and evaluate primers in vitro Pre-design co

4、nsiderations Choosing the gene and accession number Use only mRNA accession numbers Amplicon length and space between peaks Design using NCBI Primer-BLAST Amplicon lengths Design primers to detect all transcript variants (if not specified) or a unique transcript variant (if specified) Design primers

5、 to avoid amplifying transcribed pseudogenes Design intron-spanning primers when possible Exclude SNPs from primersStrategic ApproachObtain mRNA accession numbers or use gene sequenceCheck gene for transcript variants, pseudogenes and intron information: Entrez Gene(See Specific Design Consideration

6、s)Design primers using Primer BLASTEnter primer name, fragment size, gene name into multiplex TDF file templateDetermine the desired length of amplicon (without universal tags)1. Choosing an Accession Number A single gene can be represented in the NCBI database by multiple accession numbersmRNA Alwa

7、ys use reference sequence (RefSeq) (NM_XXXXXX) from the Database Use caution with other mRNA accession numbers - partial sequences- mutations- ESTs Do not use an accession number for genomic sequences2. Ensure the following for each accession number that is chosen: Correct gene is chosenMultiple nam

8、es and aliases Different genes can have similar names Species of interest If non-RefSeq accession number is used Verify that the sequence contains only the letters A, T, G, C or NPre-Design ConsiderationsAmplicon LengthDesign amplicons such that each fragment is no less than 5 nucleotides apart from

9、 its nearest neighbor.This allows for variation in migration to meet the minimum peak separation distance of 3 nucleotides.Design amplicons between 105 350 nt (without universal tags)142 387 nt with universal tagsStart with small fragment size and work toward larger fragment sizeNote: For FFPE sampl

10、es, design amplicons between 105-160 nt (without universal tags), the recommended total number of fragments in a panel is twenty or less.Pre-Design Considerations-Continue Gene Information Intron and Exon Information Transcript Variants Information Pseudogenes InformationPre-Design Considerations-Co

11、ntinue1. Choose the database2. Enter gene name or accession number3. Click SearchNCBI web or directly go to /gene/Step1: Getting Gene InformationGet the alias(es) and a summaryExample: NM_01825View the transcripts and reference sequencesELP2 contains a single transcript wit

12、h 22 exonsEach green bar represent an exon.ELP2 located at the Chromosome 18Step 2: Checking for homology and pseudogenesPerform a species-specific queryBlast human genome if it is a human geneGo to /Blast.cgiEnter the accession # hereSelect “reference only” databaseClick

13、 “Begin Search”Click “View Report”Click View Report to view gene information Only one hit, theres no high homologous region or pseudogenes.Click on the link to go to the map view and intron-exon information.Report view pageBlack hash marks indicate exon-exon boundariesNM_018255Go to http:/blast.ncbi

14、./Blast.cgiScroll down to find the Specialized BLAST, click Primer BLASTStep3: Design Gene-Specific Primers NCBI Primer-BLASTThis program will accomplish the following when the parameters are set properly: Check for specificity both within a species and between species (must add species)

15、Include or exclude transcript variants Exclude SNPs from the primer binding sites Create intron-spanning primers and/or exon-junction primers Allows for design to specific regions within the gene or using a pre-designed primer sequences Avoids low complexity primer binding regions Note: Generally th

16、e more restrictions that are placed on the primer selection program, the fewer primers binding sites will be available This program does NOT: Check for repeat sequences within the amplicon which may lead to stutter Check for pseudogenesDesign Gene-Specific Primers with NCBI 3.(optional) Specify spec

17、ific nucleotide regions for the forward and reverse primers2. Enter pre-designed primers (if any, optional)1. Enter accession number or FASTA sequence (mandatory)Primer-BLAST continued4. Specify product size (mandatory) range = 105 350 nt for XP-PCR6. Use default Tm settings1051055. Specify the # of

18、 primer sets to return (optional)8. Verify specificity by checking the box and entering the species (recommended)9. Include splice variants by checking this box (optional). Try to exclude splice variant by leaving it blank.7. Check this box to design intron spanning primers)Recommended 500 as MinCli

19、ck Advanced parameter for more options12. Change Default Salt correction formula and Thermodynamic Parameters as indicated belowSalt = Schinderkraut & Lifso 1965 Tm = Breslauer et al. 198613. Click “Get Primers to obtainresults11. Exclude SNPs from the primer binding site.ResultsPrimer Design contin

20、ueAdd the universe taq sequence to each of the gene specific primer sequence as the final primer sequenceExample:Forward Sequence with the Universal Taq SequenceAGGTGACACTATAGAATATGATCGGGTCTTCCTTCATCReverse Sequence with Universal Taq SequenceGTACGACTCACTATAGGGAGCCATTAAGGCCCTTCTTTCThe designed fragm

21、ent size is the gene specific size plus 37bp of the universal taq, eg, the designed size is 105bp, the expected product size is 142bp.Order primers with Universal Tags, except KanR (in buffers)1. Keep the all header columns information unchanged.2. Change a new multiplex name (cell A2) when the mult

22、iplex information was modified.3. Primer name, GeXP product size, Gene Name and Accession number information are essential.4. Enter same information for both Gene Name and Accession number columns. 5. Use the actual CEQ fragment size in the product size with universal taq column6 Row 3 has to be emp

23、ty7. Keep at the last line of primer name.Create a Multiplex from a TDF file templateWhat is the TDF File ?The TDF file contains the multiplex information and that links the X-Profiler Analysis with the imported GeXP csv data.A multiplex can be uploaded into eXpress Profiler from administrator accou

24、nt with a valid* TDF file. Unique Multiplex Name (cell A2 in Excel spreadsheet) Row 3 has to be empty Keep all the column header unchanged. Mandatory fields to be filled: Primer Name, Gene Name, Accession Number, Product Size w/ Universals (use GeXP final product size easier for binning!). Enter sam

25、e information in the Gene Name and Accession Number (Can be gene name or accession number). Primer name do not include ()(), otherwise the quotation marks will created when you modified the TDF, the TDF will fail to be imported.Specific Primer Design Considerations Targeted specific transcription va

26、riants Excluded pseudogenesExample: Targeted Primer Design for BIRC5/gene/Target the 5 exon1-2 to capture three variantsGo to Nucleotide home /nuccore, enter accession #BRC5 gene has three transcript variantsClick GraphicsGo to NCBI Nucelotide home

27、 /nuccore, enter accession #Graphic to view exon information Example: NM_001012271, five exonsRight click the exon bar to view exon positionsHas to reduce the intronsize in order to designprimer between exon1-2.Primer Designed: Specific the forward primer and reverse positi

28、onsPrimer Designed: Selected “Allow to amplify splice variantsResultsPrimers targeted three transcript variantsDesign primers to regions unique to the real mRNA.Design Primers excluding the PseudogenesWhy design primers spanning an intron? To avoid genomic DNA interference from Samples resistant to

29、DNase Samples too small to be treated with DNase Single cell analysis To minimize or eliminate RT minus control Saving for reagents and time Note: This step is optional or sometimes impossible step for certain multiplex panelOptional when DNase treatment will be performed routinelyImpossible when ge

30、ne/variant specificity is only in the 3UTR (no introns).0500010000150002000025000300003500095100105110115120125130135140145150155160R tm inus A .G 02_0 80828 08J6S ize (nt)Plex B RT minus controlEach primer pair was designed on different exons to avoid interference from genomic DNA contamination.No

31、false positive025005000750010000125001500011011512012513013514014515015516016517017535xR T -F 1.25ul.G 02_08080409M 9S ize (nt)D y e S i g n a l S T A T 1 C P E B 4 N F 1 M M D D U S P 3 E R B B 3 S T A T 2 F R A P 1 L C K R N F 4 T B P G A P D H A C T BPlex A RT minus controlMultiple false positive

32、s / false signalPrimers were designed without spanning intron. Multiple false positives in RTminus although samples were DNase treated.Other Considerations Designing primers for gene family members Designing primers for splice variants Choosing quality reference (housekeeping) genes XP-PCR Primer Sp

33、ecificationsDesign gene-specific primers for gene family members When gene family members are involved, proprietary sequences should be created using non-homologous sequences. If a block of non-homologous sequence is not available, individual primer sets should be designed prior to the multiplex des

34、ign. The primer should have its 3 end land in non-homologous region. Design gene-specific primers for gene family members, when using proprietary sequence is not an option Perform alignment Pick a reverse primer that has its 3 end land on non-homolog region Paste the primer sequence into right prime

35、r window Pick a forward primer that has its 3 end land on non-homologous region Paste the primer sequence into left primer window Click Execute This task can also be performed via Primer-BLAST at/tools/primer-blast/index.cgiExample: design gene-specific primer regions for C

36、YP6Z1Alignment of CYP6Z family p450|cdna|CYP6Z1 GTCTACTGCAACGAGCACAGTGATCCGATGTCGGCCAACCTGTTCGCCCTGCCCGGCCAG 360 p450|cdna|CYP6Z3 GTCTACTGCAATGAAGAGCACGATCCCTTCTCGGCCAATCTGTTCGCTCTGCCCGGTCAG 360 p450|cdna|CYP6Z2 GTCTACTGCAATGAAGAGCACGATCCCTTCTCGGCCAATCTGTTCGCTCTGCCCGGTCAG 360 * * * * * * * * * * * *

37、 p450|cdna|CYP6Z4 CGCTGGAAGCGGCTGCGGGCGAAGCTCACGCCGACCTTCACGTCCGGCCAGCTGCGCCAG 420 p450|cdna|CYP6Z1 CGGTGGAAAAATCTGCGTGCGAAGCTTACACCAACCTTCACCTCCGGCCAGCTACGGCAC 420 p450|cdna|CYP6Z3 CGGTGGAAGAACTTACGTGCGAAGCTCACGCCGACCTTCACGTCCGGACAACTGCGTAAC 420 p450|cdna|CYP6Z2 CGGTGGAAGAACTTACGTGCGAAGCTCACGCCGACC

38、TTCACGTCCGGACAACTACGTAAC 420 * * * * * * * * * * * * * p450|cdna|CYP6Z4 ATGATGCCCACGTTTCTGGACGTGAGCGAGAAGTTGCTGGCCGAGCTGGAACCGTTGGCG 480 p450|cdna|CYP6Z1 ATGCTGCCAACGTTTCTGGCAGTGGGCAGCAAGCTCGAGCAGTATCTCGAACGCTTGGCA 480 p450|cdna|CYP6Z3 ATGCTCCCCACTCTCCTGGACGTCGGCAACAAGCTGATCGATCGTATGAACAAGGTGGCG 480

39、 p450|cdna|CYP6Z2 ATGCTCCCCACTCTCCTGGACGTCGGCAACAAGCTGATCGATCGTATGAACAAGGTGGCG 480 * * * * * * * * * * * * * p450|cdna|CYP6Z4 GCGGAGGGCCGCGTGGTCGATATGCGGGACATTTCGTCGCGCTACGTGCTGGACGTGATC 540 p450|cdna|CYP6Z1 AACGAAAAACAGATCGTCGACATGCGTGACATCGTTTCGCGCTACGTGCTCGATGTGGTG 540 p450|cdna|CYP6Z3 GACGAGAAGG

40、CGATCGTTGATATGCGTGATATTGCGTCACGGTTTGTGCTCGACACGATC 540 p450|cdna|CYP6Z2 GACGAGAAGGCGATCGTTGATATGCGTGATATTGCGTCACGGTTTGTGCTCGACACGATC 540 * * * * * * * * * * * * * * p450|cdna|CYP6Z4 GCGACCGTGTTCTTCGGCTTCGAGACGCACTGTTTGCGCGATCCGAACGATCCGTTCGTG 600 p450|cdna|CYP6Z1 GCTTCAGTGTTTTTCGGCTTCGAAGCAAACTGTCTG

41、CACGATCCCGACGATGCGTTCCGT 600 p450|cdna|CYP6Z3 GCTTCGGTGTTCTTCGGCTTCGAGGCAAACTGTATTCACAACTCGGAAGATCCCTTCCTA 600 p450|cdna|CYP6Z2 GCTTCGGTGTTCTTCGGCTTCGAGGCAAACTGTATTCACAACTCGGAAGATCCCTTCCTA 600 * * * * * * * * * * * * * * * p450|cdna|CYP6Z4 GAGCCGCTGCGCGATCTGAACAATCCAAACAGCTTCGTGAACAACATTCGGTCGGCGGGT

42、 660 p450|cdna|CYP6Z1 GTGGCGTTGCGTGATCTCAACAATCCGGACAGCTTCATCAACAACATCCGAACGGCCGGT 660 p450|cdna|CYP6Z3 TCGACACTGCAGCGTTTGACTAAGAGTAGAAAGTTTATGGATAACTTCCGAACATCTGGT 660 p450|cdna|CYP6Z2 TCGACACTGCGCCGTGCTAATCGGGGACGCAACTTTATCGATAACTTCCGTTCGTCTGGT 660 * * * * * * * * * * * * * * * mRNAThis will only

43、work if exon 2 is small enough ( 200 nt)1234v1134v21234120 nt300 ntAmplicon1234Now it doesnt matter how big exon 2 is.Design an exon 1-exon 3 junction forward primer for v2120 ntnt1251234v1134v2mRNAAmplicon4123Design an exon 2-exon 3 junction reverse primer for v11234v1134v2100 ntDoes not amplifymRN

44、AAmpliconChoosing Quality Reference Genes Equivalent expression of each reference gene over all samples (tissues, treatments, time points) examined GeXP Human ReferencePlex No psuedogenes present or target a unique region in the reference gene Use multiple (3+) reference genes for normalization Add

45、more than and then choose which ones to use for studyHousekeeping (Reference) Genes Primers availableTBP (NM_003194)170bp, 212bpPSCM4(NM_153001)143bp, 271bpHRT1(NM_000194)234bpCCNG1(NM_004060)278bpGUB2 (NM_000181)198bpRPLP0(NM_053275)115bp, 127bpGAPDH(NM_002046)248bpMousemTBP(NM_013684)151bpmGUB2(NM

46、_010368)238bpmCCNG1(NM_009831)281bpmGAPDH(NM_008084)349bpHumanGAPDH has many pseudogenesIt is impossible to design primers around all the pseudogenes.XP-PCR Primer SpecificationsFeatureminoptimal maxunitTm*57 6063 oC Length17 2023 nt Amplicon Size105 -350nt*The default values for Table of thermodynamic parameters and Salt correction formula (under advanced parameters) have been changed in NCBI Blast to values recommended in primer3 program. Table of thermodynamic parameters is changed from Bresl