生物学RNA的生物合成和加工

1、In 1961 the DNA dependent RNA polymerase was discovered in E coli and the study on the mechanism of transcription began. In 1982 Thomas Cech discovered that one of the precursor RNA in Tetrahymena chould act as a catalyst and catalyzed self-splicing. It is a ribozyme. Section 1 DNA dependent RNA syn

2、thesis RNA synthesis is catalyzed by DDRP ( or simply RNA polymerase. ) Characteristics of RNA synthesis Template DNA ( one strand DNA in dsDNA, template strand ) Substrate four kinds of NTP Enzyme DDRP ( no reqirement of primer, no proof-reading function ) Direction of RNA chain 5 to 3 synthesis Ba

3、se pairing GC TA AU rule Inorganic Mg+ Zn+ ion The process of transcription can be divided into three stages: initiation, elongation and termination. see the fig. on the blackboard The two strands in dsDNA are complementary. They are the coding strand and the template strand. The template strand wor

4、ks as the template for the synthesis of RNA. The synthesized RNA is complementary to the template strand. Its sequence is the same as that of the coding strand with the exception of the substitution of U for T. eg. 5 CGCATTAACG 3 coding strand 3 GCGTAATTGC 5 template strand 5 CGCAUUAACG 3 RNA transc

5、ript The Reaction ( NMP )n + NTP - ( NMP )n+1 +PPi Asymmetric Transcription - - _ _ - - In dsDNA one strand is coding strand. It is not transcribed. The other strand is template strand. It is transcribed. In a segment of dsDNA the coding information of genes may be in different strands. RNA polymera

6、se There is only one type of RNA pol in prokaryotes while there are three types of RNA pols in eukaryotes. E coli RNA polymerase E coli RNA pol catalyzes synthesis of all the RNAs ( mRNA , rRNA , tRNA etc ) Structure of E coli RNA polymerase The holoenzyme of E coli RNA pol contains 2() subunits The

7、 subunit can be dissociated from the holoenzyme. The RNA pol without subunit is called core enzyme: 2() Function of the Subunit can recognize promoters and initiate transcription. can bind regulatory proteins and control the transcriptional . rate. + catalyzes RNA synthesis. There may be subunit. It

8、s function is unknown. There are different kinds of subunits. The most common one is 70. Eukaryotic RNA polymerases RNA pol I RNA pol II RNA pol III _ Product 45SrRNA hnRNA tRNA synthesized ( precursor ( precursor 5SrRNA precursors of 18S, 28S of mRNA) snRNA 5.8S rRNAs) _ Sensitivity to no high inte

9、rmediate -amanite _ Structure of Eukaryotic RNA pols Each type of eukaryotic RNA pols contains two different large subunits and ten odd small subunits. The largest subunit of RNA pol II contains consensus sequence at the carboxyl terminal called CTD. CTD is composed of several dozens of heptad ( YSP

10、TSPS ) repeats. CTD Function RNA pol II with the unphosphorylated CTD participates in the beginning of transcriptional initiation. During the process of intiation many Ser and some Tyr residues of CTD are phosphorylated. RNA pol II with the phosphorylated CTD fulfills the initia- tion and leaves the

11、 promoter. RNA synthesis enters in the stage of elongation. Prokaryotic Transcriptional Initiation Prokaryotic RNA pol binds the promoter and initiates transcrip- tion. Promoter : DNA sequence that is usually upstream of a genes coding sequence and that RNA pol binds and initiates transcrip- tion. s

12、ubunit can recognize the promoter E coli promoters extend from 70 to +30 of the initiation site (+1) Most of them have two regions of consensus sequence , the -35 region ( TTGACA ) and the -10 region ( Pribnow box TATAAT ). 70 can recognize the consensus sequence. Some promoters of genes with high t

13、ranscriptional rate have another consensus region , the AT-rich up-element (-40 to -60 ) which subunit binds. The holoenzyme of RNA pol binds the promoter via subunit. strong promoter / weak promoter It is the -35 and -10 regions and the distance between them and the distance between 10 region and t

14、he transcriptionnal initiation site , that determines the transcriptional rate. The more similar the 35 and 10 regions of a promoter to the consensus sequences of TTGACA and TATAAT , the stronger affinity it has for RNA pol binding. That results in the higher transcriptional rate. And vice versa. Pr

15、ocess of Prokaryotic Trancriptional Initiation RNA pol recognizes and binds the promoter. That forms a close transcription complex. DNA double helix near 10 region unwinds. That results in an open transcription complex. Transcription begins. A triple-element complex of DNA, RNA pol and the newly syn

16、thesized RNA forms The formation of the triple-element complex causes con- formation change. RNA pol leaves the promoter and elongation begins. As the elongation begins the subunit dissociates from RNA pol. It is the core enzyme of RNA pol that is responsible for the elongation. Eukaryotic Transcrip

17、tional Initiation Eukaryotic RNA pols alone can not initiate transcription. Only with the help of transcription factors can they fulfill the task of initiation. Transcriptional initiation of RNA pol II needs not only the enzyme but also multiple transcription factors. There are consensus sequences i

18、n many of the RNA pol II recognized promoters. They are 30 region ( TATA box ) and +1 region ( the ini- tiation site , initiator , Inr ). The initiation stage of RNA pol II can be divided into two steps : the assembly step and the initiation step. The Assembly Step TBP ( TATA-binding protein ) binds

19、 TATA box. TFIIB ( or with TFIIA ) binds TBP and promoter. With the help of TFIIF , RNA pol II- TFIIF complex inter- actes with TFIIB and binds TFIIB and promoter. Then TFIIE and TFIIH join them. RNA pol II and the TFII factors form a close initiation com- plex on the promoter. The Initiation Step T

20、FIIH has both the helicase and the kinase activities. It unwinds dsDNA. The close initiation complex becomes the open initiation com- plex. TFIIH also catalyzes phosphorylation of CTD. RNA pol II with phosphorylated CTD initiates transcription. The Initiation Stage of RNA pol I or RNA pol III The in

21、itiation stage of RNA pol I or RNA pol III is similar to that of RNA pol II. The transcription factors recognize and bind the promoter. RNA pol I or RNA pol III joins them to form an initiation complex. Initiation begins. Initiation Stage of RNA pol I rDNA ( contains genes of 18 S rRNA, 28 S rRNA an

22、d 5.8 S rRNA ) is transcribed by RNA pol I. The product is 45SrRNA There are two consensus sequences in rDNA promoter : core element ( +1 region ) and UCE ( upstream control element ). Transcription factor UBF binds UCE first. Then transcription factor SL1 binds core element. RNA pol I joins them. T

23、hey form a complex on promoter. Initiation begins. RNA pol III initiates transcription of 5SrRNA gene or tRNA gene. There are internal promoters in such genes. Internal promoter means the promoter within the coding region of the gene. tRNA genes promoter has two consensus sequences : A box and B box

24、, while 5SrRNA genes promoter has only one con- sensus sequence : C box. Transcriptional Initiation of 5SrRNA Gene TFIIIA binds C box. TFIIIC and TFIIIB bind TFIIIA. RNA pol III binds them. A complex is formed. RNA pol III initiates transcription. Initiation RNA pol I RNA pol III RNA pol II _ ATP re

25、quirement no no yes _ A and B or TATA box core consensus sq. core element C box Inr _ CAAT box upstream element UCE GC box etc _ general TFs SL1 TFIIIA B C various TFIIs _ upstream factors UBF various up- stream factors _ Transcriptional Termination There are two types of transcriptional termination

26、 in prokaryotes independent and dependent. independent termination There are two characteristics of independent termination sq. ( terminator ). A segment of GC-rich , self-complementary sq. It is followed by a series of T. eg GCCGCCAGTTCGGCTTGCCGCCTTTT The RNA synthesized is also self-complementary

27、and forms a stem-loop structure followed by aseries of U. U U 5 GCCGCCAG C CGGCGGUC U U GG U U U 3 RNA pol interacts with the structure and stops at the template The UA pairs are unstable. The newly synthesized RNA re- leases from the template. Transcription terminates. dependent termination The ter

28、minator of the dependent termination is not typical. It contains CA-rich region which factor can recognize. factor is a homo-hexamer protein factor , can bind the newly synthesized RNA and moves to the RNA-DNA hybrid region. factor has helicase activity and unwinds the RNA-DNA helix depending on the

29、 energy released from ATP hydrolysis. Section 2 Posttranscriptional Processing Mature eukaryotic mRNA has experienced 5- and 3 end processing and splicing. hnRNA ( or mRNA ) is capped at 5 end Most hnRNA have a cap of 7-methylguanosine triphosphate ( m7Gppp-) at the 5 end. It is added to the 5 end o

30、f the growing transcript of 25-30 nucleotides via 55 triphosphate linkage. The cap protects hnRNA ( and mRNA ) from Rnase attack and participates in the binding of mRNA and ribosome. hnRNA ( or mRNA ) has a poly A tail at the 3end Almost all of eukaryotic hnRNAs ( or mRNAs ) have a poly A tail of 80

31、-250 nucleotides at the 3end. It is enzymatically added to the primary transcript intwo stages. Cleavage The transcript is cleaved 10 to 30 nucleotides past a highly conserved AAUAAA sq ( the polyadenylation signal sq ) and within 50 nucleotides before a GU-rich sq. 10-30nts G -A-AG= Exon1 and exon2

32、 are connected. Lariat form of intron is re- leased. Splicing is completed. = = G -A-AG The previously described splicing takes place in the spliceosome. Spliceosome contains snRNPs which are composed of snRNAs and proteins. snRNAs in snRNPs are U-rich, and called URNAs. There are 5 URNAs. .The proc

33、ess of splicing in the spliceosome includes spliceo- some assembly, spliceosome activation and splicing An eukaryotic gene may direct transcription of different hnRNAs from different promoters or using different poly- adenylation sites. There are two promoters in glucokinase gene. In the liver cell

34、transcription initiates from the second pro- moter which is near the coding sq, while in the pancreatic cell transcription initiates from the first promoter which is upstream located. This is an example that one gene can express different hnRNAs ( and mRNAs ). In the different developmental stages o

35、f lymphocyte B 3 end processing of the hnRNA of chain can use dif- ferent polyadenylation sites and yield different hnRNAS ( and mRNA ) This is another example. Alternative Splicing Provides for Different mRNAs from the Same hnRNA The mechanism of alternative splicing includes the selective inclusio

36、n or exclusion of exons, the use of alternative 5do- nor or 3 acceptor sites. exon1 exon2 exon3 =-=-=hnRNA splicing1 (mRNA1) splicing2 (mRNA2) exon1 exon2 exon2 exon3 = = = = splicing3 (mRNA3) exson1 exon2 exon3 = = = hnRNA =-=-= 2 donor sites in exon1 2 acceptor sites in exon3 3mRNAs = = = exon 1+2

37、+3 = = = part of exon 1+e2+e3 = = = e1+e2+ part of exon 3 rRNA precursor processing requires Rnases prokaryotic 30SrRNA precursor- methylation - Rnases cut - precursors of 23SrRNA, 16SrRNA 5SrRNA and tRNA- Rnases cut - 23SrRNA 16SrRNA , 5SrRNA and tRNA eukaryotic 45SrRNA precursor-methylation -snoRN

38、P mediated processing-precursors of 18SrRNA , 28SrRNA , 5.8SrRNA -snoRNP mediated processing - 18SrRNA , 28SrRNA , 5.8SrRNA tRNA precursor processing tRNA precursor processing in prokaryotes and eukaryotes are similar. It includes 5end cutting 3end cutting and CCA adding (if there isnt CCA) splicing

39、 (if there is intron , splicing takes place via enzymatic cutting and joining) base modification. Self-splicing Catalyzed by RNA In 1982 T. Cech discovered that the intronof Tetrahymena rRNA precursor could catalyzed self-splicing. The intron that can catalyze self-splicing belongs to the group I in

40、tron. Group I intron catalyzes self-splicing with the help of cofactor guanosine or guanosine phosphate The self-splicing includes two transesterfication reactions 5=-=3 exon 1 exon 2 5=-=3 G-OH G-OH attacks the first nucleotide at the 5end of the intron. Exon 1 is released. 5=OH G-=3 Exon 1s 3end a

41、ttacks the nucleotide at the 3 end of the intron. G-=3 5=OH Two exons are connected. The intron is released. 5= =3 G-OH There are group II introns , which can also catalyze self- splicing. They catalyze self-splicing just like the previously mentioned lariat-form splicing. It also includes two trans

42、esterification reactions but does not take place in spliceosome and does not require any cofactor. Group I and group II introns are ribozymes. Some mRNAs Undergo Editing Coding information can be changed at the mRNA level by RNA editing. In such cases the coding sq of the mRNA differs from that in t

43、he cognat DNA. RNA editing is discovered first in protozoan and mediated by g-RNA. Some nucleotides can be changed in or added into or deleted from the mRNA coding sq by RNA editing. That results in change of the genetic codon and / or the reading frame of the coding sq. The expressed protein is cha

44、nged. An example of human RNA editing is the apolipoprotein B mRNA. In liver the single apoB gene is transcribed into an mRNA that directs the synthesis of a 100 Kda protein . In the intestine the same gene directs the synthesis of the primary transcript however acytidine deamination converts a CAA

45、codon in the mRNA to UAA at a single specific site. Rather than encoding glutamine this codon becomes stop codon and a 48 Kda protein is the result. Section 3 RNA dependent RNA synthesis RNA as genetic material All plant viruses, several bacteriophages and many animal viruses have genomes consisting

46、 of RNA. There are three types of RNA genomes : dsRNA, ssRNA and two copies of the same ssRNA. The dsRNA and ssRNA are replicated by RNA replicase ( RNA dependent RNA polymerase, RDRP ). In most cases RNA genome is single stranded. There are two subtypes of ssRNA genomes the +ssRNA and the ssRNA. +s

47、sRNA genome functions both as genetic material and mRNA, while ssRNA genome serves only as genetic material. Viruses with ssRNA genomes use the ssRNA as a template for the synthesis of a complement strand , which can then serve as template in replicating the original strand. Retroviruses have two co

48、pies of the same ssRNA as the genome. They carry the reverse transcriptase. It has three enzymatic activities : RDDP , DDDP and Rnase H Structure of E coli RNA polymerase The holoenzyme of E coli RNA pol contains 2() subunits The subunit can be dissociated from the holoenzyme. The RNA pol without su

49、bunit is called core enzyme: 2() strong promoter / weak promoter It is the -35 and -10 regions and the distance between them and the distance between 10 region and the transcriptionnal initiation site , that determines the transcriptional rate. The more similar the 35 and 10 regions of a promoter to the consensus sequences of TTGACA and TATAAT , the stronger affinity it has for RNA pol binding. That results in the higher transcriptional rate. And vice versa. There are consensus sequences in many of the RNA pol II