群体遗传学基础和重测序分析课件

1、群体遗传学基础和重测序分析 Population genetics genetic structure of a population genetic structure of a populationgroup of individualsof the same speciesthat can interbreedPopulation geneticsPopulation genetics genetic structure of a populationgroup of individualsof the same speciesthat can interbreed alleles ge

2、notypes50 AA50 Aa100 aaTotal= 200 fishesGenotype Frequencies50/200 = 0.25 AA50/200 = 0.25 Aa100/200 = 0.50 aa Allele Frequencies(50*2+50)/400 = 0.375 A(50+100*2)/400 = 0.625 aGenotype and Allele Frequenciesdescribes a mathematical relationship between allele frequencies and genotype frequencies:The

3、Hardy-Weinberg PrincipleThe Hardy-Weinberg PrincipleFeature 1Allele frequencies in a population will not change, generation after generation. The population is sufficiently largeMating is randomAllele frequencies are the same in males and femalesSelection does not occur (all genotypes have equal in

4、viability and fertility)Mutation and migration are absentNo selection, mutation, drift, migration, non-random matingThe Hardy-Weinberg PrincipleFeature 2Another important implication is that for a rare allele, there are many more heterozygotes than there are homozygotes for the rare alleleTesting fo

5、r H-W Equilibrium Example 1Population sampleGenotypesAllele frequenciesAAAaaaAa1002080010036481610050203010060040Only one of the populations below is in genetic equilibrium. Which one?Population sampleGenotypesAllele frequenciesAAAaaaAa100208000.60.41003648160.60.41005020300.60.4100600400.60.4Only o

6、ne of the populations below is in genetic equilibrium. Which one?Testing for H-W Equilibrium Example 1Population sampleGenotypesAllele frequenciesAAAaaaAa100208000.60.41003648160.60.41005020300.60.4100600400.60.4Only one of the populations below is in genetic equilibrium. Which one?Testing for H-W E

7、quilibrium Example 1Data: 26 MM, 68 MN, 106 NN, with a total population of 200 individuals.1. Observed genotype frequencies: MM: 26/200 = 0.13MN: 68/200 = 0.34 NN: 106/200 = 0.532. Allele frequencies:M: 0.13 + 1/2 * 0.34 = 0.30N: 0.53 + 1/2 * 0.34 = 0.703. Expected genotype frequencies and numbers:M

8、M: p2 = (0.30)2 = 0.09 (freq) x 200 = 18MN: 2pq = 2 * 0.3 * 0.7 = 0.42 (freq) * 200 = 84NN: q2 = (0.70)2 = 0.49 (freq) * 200 = 984. Chi-square value: (26 - 18)2 / 18 + (68 - 84)2 / 84 + (106 - 98)2 / 98 = 3.56 + 3.05 + 0.65 = 7.265. Conclusion: The critical chi-square value for 1 degree of freedom i

9、s 3.841. Since 7.26 is greater than this, we reject the null hypothesis that the population is in Hardy-Weinberg equilibrium. Testing for H-W Equilibrium Example 2Population genetics genetic structure of a populationgroup of individualsof the same speciesthat can interbreed alleles genotypesPatterns

10、 of genetic variation in populationsChanges in genetic structure through timeATCGGGTATGCTTATCGGGGATGCTTATCGGGTATGCTTATCGGGGATGCTTATCGGGGATGCTTATCGGGTATGCTTSingle Nucleotide Polymorphism (SNP)ATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTA

11、TCGGGT GGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTATCGGGTATGGTATGCTTShort insertion and deletion (InDel)DeletionInsertionStructure variation (SV)Genetic variationsGenetic variationsvariationno variationEXTINCTION!globalwarmingsurvival adaptation to environmental

12、 changeWhy is genetic variation important?Why is genetic variation important?variationno variationnorthsouthnorthsouthdivergence of populationsWhy is genetic variation important?variationno variationnorthsouthnorthsouthdivergence of populationsdivergenceNO DIVERGENCE!Ps = S/nSegregating Sites：S = 6w

13、 = Ps / a1E(Ps) = a1a1 = 1+2-1+3-1+(m-1)-1mn = 4NAverage Pairwise Differences:dij = Dij / n;c = m(m-1)/2Polymorphism (SNPs)changes in allele frequencies and/or genotype frequencies through timeHow does genetic structure change? mutation migration natural selection genetic drift non-random matingHow

14、does genetic structure change?changes in allele frequencies and/or genotype frequencies through time mutation migration natural selection genetic drift non-random matingspontaneous change in DNA creates new alleles ultimate source of allgenetic variationHow does genetic structure change? introduces

15、new allelesindividuals move into populationHow does genetic structure change? mutation migration natural selection genetic drift non-random mating“gene flow”migrationHHhhhH differences in survival or reproductioncertain genotypes produce more offspring leads to adaptationdifferences in“fitness”How d

16、oes genetic structure change? mutation migration natural selection genetic drift non-random matingNatural selectionDirectional selection (positive selection)Stabilizing selection (negative selection)Disruptive selection (diversifying selection)Resistance to antibacterial soapNatural selectionGenerat

17、ion 1: 1.00 not resistant 0.00 resistantNatural selectionResistance to antibacterial soapGeneration 1: 1.00 not resistant0.00 resistantNatural selectionResistance to antibacterial soapmutation!Generation 1: 1.00 not resistant 0.00 resistantGeneration 2: 0.96 not resistant 0.04 resistantNatural selec

18、tionResistance to antibacterial soapGeneration 1: 1.00 not resistant 0.00 resistantGeneration 2: 0.96 not resistant 0.04 resistantGeneration 3: 0.76 not resistant 0.24 resistantNatural selectionResistance to antibacterial soapGeneration 1: 1.00 not resistant 0.00 resistantGeneration 2: 0.96 not resi

19、stant 0.04 resistantGeneration 3: 0.76 not resistant 0.24 resistantGeneration 4: 0.12 not resistant 0.88 resistantNatural selection can causepopulations to divergedivergencenorthsouthaa abnormal hemoglobin sickle-cell anemiavery lowfitnessSelection favors heterozygotes (Aa)Both alleles maintained in

20、 population (a at low level)highfitnessAa both hemoglobins resistant to malariaIntermedfitnessAA normal hemoglobin vulnerable to malariaaASelection on sickle-cell allele sampling errorgenetic change by chance alone misrepresentation small populationsHow does genetic structure change? mutation migrat

21、ion natural selection genetic drift non-random matingGenetic drift8 RR8 rrBefore:After:2 RR6 rr0.50 R0.50 r0.25 R0.75 rGenetic drift - Bottleneck Effecta drastic reduction in population (volcanoes, earthquakes, landslides )Reduced genetic variationSmaller population may not be able to adapt to new s

22、election pressuresGenetic drift - Founder Effectoccurs when a new colony is started by a few members of the original populationReduced genetic variationMay lead to speciation mutation migration natural selection genetic drift non-random matingcause changes inallele frequenciesHow does genetic struct

23、ure change? mutation migration natural selection genetic drift non-random matingHow does genetic structure change? non-random mating non-random allele combinationsmating combines alleles into genotypes Non-random matingResequencing &Population GenomicsdxyFstw Linkage DisequilibriumTajimas DDe novoRe

24、-sequencingreferencereferenceResequencingEvolutionary AnalysisDomestication and the genomic signature of artificial selectionPrinciple Component AnalysisConvert a set of observations of possibly correlated variables into a set of values of linearly uncorrelated variables called principal componentsA

25、 variable reduction procedurePhylogenetic reconstructionEstimate relationships between organisms or genesConstructing a tree based on the differencesNJ, MP, ML methodStructure analysisAssume a model in which there are K populationsIndividuals in the sample are assigned (probabilistically) to populat

26、ionsLinkage disequilibrium influenced by many factors, including selection, the rate of recombination, the rate of mutation, genetic drift, the system of mating, population structure, and genetic linkage.Artificial selection often elevate LD levelSelection sweepsDomestication of rice: wild/cultivatedD0: low levels of both low and high frequency polymorphisms; indicating a decrease in population size and/or balancing selectionD0: an excess of low frequency polymorphisms; indicating selective sweep and/or purifying