Chapter2TheMoleculesofCells2章细胞的分子

1、types of energy in biological systems kinetic energy - energy of motion, work done potential energy - stored energy, can be released to do work archer draws bowstring back - used kinetic energy tension now in bowstring represents potential energy release of bowstring converts potential energy to kin

2、etic energy total energy in universe is constant energy cannot be created or destroyed energy can be converted from one form to another the pathway of conversion is irrelevant, the energy change between identical initial and final states is equal when it comes to energy-you cant get ahead!no convers

3、ion is 100% efficient. total useful energy in a closed system decreases as conversions occur. closed systems go from complex to simple.entropy measure of disorder closed systems tend to their highest state of disorder entropy of the universe increases with every conversionrandomness is spontaneous i

4、n a closed system beaker on left has different colored marbles separated from each other highly ordered system low entropyexamples of entropylow entropyhigh entropy beaker on right has different colored marbles scattered amongst each other highly disordered system high entropyother examples?what hap

5、pens if you achieve equilibrium?atoms1 valence e-andif an atom has 7 valence e-, its happy to pick up oneex. chlorine7 valence e-carbon (c) 4cchhydrogen (h) 1 cchhhhmethane ch4each pair of electronsrepresents the formationof a covalent bond.amazing stuff!should not be a liquid at room temphighly pol

6、ar molecule. positively charged hydrogen endnegatively charged oxygen endhydrogen bondscovalent bonds between hydrogen and oxygenif ph7, base7=neutralmonomerpolymerabohh+ hoh or h2oabcovalent bondsif the reaction is carried out multiple times you create a polymer!+ h2o moleculescondensationhydrolysi

7、sdehydration (condensation) builds. hydrolysis breaks down.remember: a proteins function is a result of its form!e+s es e+pe=enzymes=substratep=productea barrierreactants1products2enzymefigure 5.5astarchglycogencellulosex3 hh-coh h-coh h-coh hglycerol o h h h h h ho-c-c-c-c-c-c-h h h h h h o h h h h

8、 h ho-c-c-c-c-c-c-h h h h h h o h h h h h ho-c-c-c-c-c-c-h h h h h h fatty acids hh-co h-co h-co h o h h h h h -c-c-c-c-c-c-h h h h h h o h h h h h -c-c-c-c-c-c-h h h h h h o h h h h h -c-c-c-c-c-c-h h h h h h + h20+ 3 h20triglyceridewhat type of reaction forms a triglyceride?dehydration synthesis+

9、h20+ h20-linolenic acidtrans -linolenic acidthe major structural component of cell membranesthe central dogmatranscription-translation-replication-rnaproteindnaduplication of dna using dna as the templatesynthesis of rna using dna as the templatesynthesis of proteins using rna as the templateatgagtaacgcgtactcattgcgcatgagtaacgcgtactcattgcgcatga