DNAWorks全基因合成介绍.ppt

1、Gene Synthesis using DNAWorks,Dr. David Hoover Helix Systems, SCB, CIT, NIH,Gene Synthesis,Several methods ligation - incredibly tedious and inefficient FokI - sequence dependent (type IIs r.e.) serial cloning - sequence dependent assembly or self-priming PCR,Gene Synthesis Methods,Thermodynamically

2、 Balanced Conventional,Thermodynamically Balanced Inside-Out,Protein Expression,Protein/Structure Independent Factors: promoters and upstream elements translational initiation and termination mRNA stability codon bias Protein/Structure Dependent Factors: folding and aggregation proteolysis and degra

3、dation secretion and localization,Codon Bias,Synthetic Genes,Benefits: Codon use optimized for host Flexibility in subcloning Ease of complex mutagenesis Problems: Time consuming Complicated Error-prone,Commercial Sources,Blue Heron Biotechnology () DNA 2.0 ( Gene Script Corporation ( BioNexus Inc.

4、( Entelechon ( GeneArt ( Codon Devices (,Commerical Sources,Typical costs: $0.79 - $3.60 / bp Complexities? Intellectual property? 800 bp = $1000 (Gene Script),Genes From Scratch,oligos $0.20 / nt (NIH discount) PCR reagents $2 / reaction sequencing $20 / 600 bp electrophoresis $3 / gel labor $20 /

5、hr GFP, 238 aa, 714 bp, 20 oligos, 1134 nt, 2 reactions, 2 gels, 4 sequences, 10 hrs = $517,How to design oligos,reverse-translate protein into DNA, optimum codon usage break into fragments of equal overlap Tm optimize: hairpins / mRNA structure repeats / mispriming restriction site inclusion / excl

6、usion length,DNAWorks,/dnaworks/,DNAWorks Output,181 TCTGGTGAAGGCGAGGGTGACGCGACCTACGGTAAACTCACTCTCAAAT agaccact TGCCATTTGAGTGAGAGTTTAAGTAGACGTGG 241 ggttccttggccgaccctggttactaccttctcttacggtgttcag TGCCCGTTTGACGGCCAAGGAACCGGCTGG tc - 6 T G K L P V P W P T L V T T F S Y G V Q | |

7、| | | | |,DNAWorks Options,Job Name E-mail Address,DNAWorks Options,Codon Frequency Table E. coli (standard, class II), H. sapiens, C. elegans, D. melanogaster, M. musculus, P. pastoris, R. norvegicus, S. cerevesiae, X. laevis Custom CFT,Gly GGG 599428.00 16.49 0.25 Gly GGA 597986.00 16.45 0.25 Gly

8、GGT 392298.00 10.79 0.16 Gly GGC 814464.00 22.41 0.34 Glu GAG 1441162.00 39.65 0.58 Glu GAA 1043166.00 28.70 0.42 Asp GAT 789799.00 21.73 0.46 Asp GAC 914677.00 25.16 0.54 Val GTG 1028789.00 28.30 0.46 Val GTA 257442.00 7.08 0.12 Val GTT 399567.00 10.99 0.18 Val GTC 528840.00 14.55 0.24 Ala GCG 2718

9、20.00 7.48 0.11 Ala GCA 579156.00 15.93 0.23 Ala GCT 672416.00 18.50 0.26 Ala GCC 1018345.00 28.02 0.40 Arg AGG 432954.00 11.91 0.21 Arg AGA 434655.00 11.96 0.21 Ser AGT 441137.00 12.14 0.15 Ser AGC 706723.00 19.44 0.24 Lys AAG 1163126.00 32.00 0.57 Lys AAA 879684.00 24.20 0.43,DNAWorks Options,Para

10、meters Annealing Temperature Oligo Length (random) Codon Frequency Threshold (random, strict, scored) Oligonucleotide, Na+/K+, Mg2+ Concentrations Number of Solutions TBIO No gaps in assembly,DNAWorks Options,Balancing act Fast, simple, cheap? Slow, complex, expensive? - reliable Reusable and interc

11、hangeable oligos?,DNAWorks Options,Others Restriction Site Screen (non-degenerate, degenerate sequences) Custom Site Screen (mind the format!) Weights (experimental),DNAWorks Options,Sequences protein (X = stop) nucleotide (can be degenerate) almost any file format reverse sequence fix sequence in g

12、ap,DNAWorks Output,Web output Input for DNAWorks (standalone version) Header Initial parameters Optimization log Final scores Final summary,DNAWorks Output,Total output Sequence blocks CFT blocks Pattern block Trials Final Summary,DNAWorks Output,Trial outputs Initial parameters Final DNA sequence A

13、ssembly Final scores Codon report Histograms Oligo sequences,Scores / Penalties,codon usage length melting temperature repeat pattern mispriming AT/GC contents gapfix,Mutant Run,Design oligos based on previous set of oligos Parameters taken from previous run For single mutation, will output 1 or 2 o

14、ligos only,What to look for,Final Summary Avoid misprimes and repeats Make sure overlaps are 12 nt (Short) Tm range should not be 3C (TmRange) Dont depend entirely on scores Arbitrary, somewhat dependent on length,Tricks,Choosing codons random - slower optimization, less constrained strict - for the

15、 fussy scored - if codon score really matters Tm, Length ranges, Number of Solutions To find the very best solution no more than 999,Tricks,Design multi-use and interchangeable oligos Flanking primers with standard overlaps Intersperse nucleotide elements between protein elements Gap-fix restriction

16、 sites Allow for mutations later on Random mutagenesis Nucleotide sequences can be degenerate,Tricks,Thermodynamically Balanced Inside-Out Mode Multi-step PCR More controlled, reliable method Gao X., et al., Nucleic Acids Res 2003 Random oligo lengths Faster, better optimization For the not-so-fussy

17、 Probably best for DNA-only genes,Tricks,Set Tm higher 64C - 70C longer oligos, extra purification ($),Always double check!,Nothing is foolproof Think carefully about what you need BEFORE starting work Always run final sequences through alternate program (EMBOSS, GCG-Lite) Make sure oligos are what

18、you intended,PCR,Mix all oligos and additives Specific PCR protocols Analytical gel Isolate desired products,Assembly Protocol,Amplification Protocol,Problems,No product (complete failure) Wrong size product (mispriming) Mutations (2 out of 3 correct, 2 errors/kb) Sequencing is warranted.,Fixes,Opti

19、mize PCR conditions Break gene synthesis into steps (TBIO),Errors,p = mutation rate / 1000 nt / duplication (Cline et al., Nucleic Acids Res 24 (1996) Taq polymerase = 0.008 KOD (Novagen) = 0.0027 PfuUltra (Stratagene) = 0.00043 The probability of a gene n bp in length having no errors using a polymerase with mutation rate p: p = (1 - p)n Therefore,