南开大学基因操作原理第三章

1、Chapter 3 Cutting and joining DNA molecular1? 1st? 3rd? 2ndin vitroin vivo2PCRRT-PCREnd modification3Overview of Useful Enzymes for Molecular Cloning2. Restriction Endonucleases 1) Host-controlled restriction and modification; 2) Restriction enzyme and modification enzyme; 3) Types of restriction en

2、zyme; 4) Nomenclature of restriction enzyme; 5) Target site of restriction enzyme; 6) Isoschizomer; 7) Isocaudamer.4 3. DNA Ligase 1) Mechanism of DNA ligase; 2) Characteristic and application of DNA ligase. 4. End Modification 1) Enzymes; 2) Double-linker; 3) Adaptors; 4) Homopolyer tailing.561. Us

3、eful Enzymes for Molecular Cloning The formation of new combinations of heritable material by the insertion of nucleic acid molecules with some enzymes (such as Restriction Endonucleases, DNA Ligase, Polymerase), produced by whatever means outside the cell. Enzyme is the formation of bio-engineering

4、 products, usually from a wild strain or eukaryotes (such as yeast) to transform or optimize.7Enzyme as tool in Gene manipulation In nature, there are some enzymes with specific function in many micro-organisms.Nucleic acid metabolismDNA replication and repairDegradation of non-self DNA8Useful Enzym

5、e as tool in Gene manipulationRestriction endonucleaseMethylaseDNA ligaseDNA polymeraseRNA polymeraseKinase and phosphataseNuclease9Enzyme as tool in Gene manipulationHost-controlled restriction and modificationRestriction enzyme and modification enzymeTypes of restriction enzymesNomenclature of res

6、triction enzymesTarget site of restriction enzymesIsoschizomerIsocaudamer102. Restriction Endonuclease1) Host-controlled Restriction and ModificationPhage infects bacteria11Two enzyme activity in host: Restriction endonuclease enzyme Modification methyltransferase 12Restriction-Modefication (R-M) sy

7、stemE. Coli BE. Coli KModified phage (B)Modified phage (K)EOP10-4（Restriction）EOP10-4（Restriction ）EOP=1（Modification） EOP=1 （Modification）13EOP: efficiency of platingPhage infects bacteriaPlating Efficiencies of Phage Grown on E.coli Strains C, K and B When Plated on These Bacteria Strain Phage C K

8、 Blambda-C 1 10-4 10-4lambda-K 1 1 10-4lambda-B 1 10-4 114The enzyme that is responsible for exogenetic DNA degradation is called a restriction endonuclease, and endonuclease for short.The enzyme that plays the function of modification via modifying exogenetic DNA is called modification enzyme, wher

9、eas restriction enzyme exert its function no longer. The modification enzyme is methylase.152) Restriction Enzyme and Modification Enzyme1617183) Types of restriction enzymeFeaturesType Type Type Restriction and modification activitiesDual functionSingle functionDual functionRecognition and cleavage

10、 siteSeparate, randomSame site5-10 bp distanceSignificanceuselessVery usefuluseless19Principles： EcoR IEscherichiagenusColispeciesRy13strainorder204) Nomenclature of restriction enzymesHind Haemophilus influenzae d(1) Structure: The recognization sequences of type II restriction endonucleases are al

11、l palindromes. The length of recognition sequence usually is 4-8 nucleotides, most common is 6 nucleotides. EcoRI 5-G A A T T C-3 3-C T T A A G-5(2) End： cohesive end the position of target sequence at which the restricting enzyme cuts usually protrudes 5 termini or 3 terminiCohesive end EcoRI 5-G-3

12、 5-AATTC-3 3-CTTAA-5 3-G-5 Blunt end-HaeIII 5-GG CC-3 3-CC GG-5 215) Target site of restriction enzymes (3) Number： Assuming a random distribution of the target sequence in the DNA sequence 4 nucleotides 44=256bp 6 nucleotides 46=4096bp (4) Relax target site: （star activity；the Second activity) The

13、specifity of the recognition sequence of restriction endonucleases is altered, causing extra cut. Conditions causing star activity: a.glycerin concentration; b.ionic strength; c.pH; anic solvent; e.bivalent cation; f.the proportion of enzyme and DNA. star activity can provide new recognition an

14、d cut site for restriction endonucleases,but commmonly cut is not complete.so it should be avioded,and the pretreatment with enzyme should be carried out under standard condition.22 EcoRI G AATT C_ N AATT N EcoRI* C TTAA G N TTAA NWorking condition of EcoRI： EcoRI EcoRI*Tris-HCl, 100mmol/l Tris-HCl,

15、 25mmol/l NaCl, 50mmol/l MgCl2, 2mmol/lMgCl2, 10mmol/l pH8.5, 370CpH7.5, 370C 23Restriction Recognition Relaxed sequencesendonuclease sequencesBamHI G/GATCC GGATCN or GPuATCCBstI G/GATCC N/GATCNBsuI GG/CC NG/CNEcoRI G/AATTC N/AATTN or PuPuATPyPySau3A /GATC GAGC or CATCTth111I TGACN/ NACN/NNGTC NNGTC

16、 GACN/NNNTC GACN/NNGNCXbaI T/CTAGA N/CTAGN or N/CTANN 24A B C C B A A B C C B AA B N B AA B N B A A B B A A B B A 或或Rotational symmetric palindromic structureThe specifity of the recognition sequence of restriction endonucleasespalindrome GGATCCCCTAGG5353BamHI25The structure of recognition sequenceI

17、nside:GGATCC、ATCGAT、GTCGAC、CCGCGG、AGCGCTBoth sides:GATC、CATG、CCAGG 26Cutting sites(a) Cohesive end, protruding 5 terminiG AATTCCTTAA GGAATTCCTTAAGEcoR53535353(b) Cohesive end, protruding 3 terminiCTGCA GG ACGTCCTGCAGGACGTCPst5353535327(c) Blunt endCCC GGGGGG CCCCCCGGGGGGCCCSma53535353The restriction

18、 endonucleases of different origin recognize the same target site (but their cut position may be different, so the end is not always the same). 286) IsoschizomerCCCGGGGGGCCCCGGGCCCCGGG C+XmaCCCGGGGGGCCCCCCGGGGGGCCC+Sma different cut position GGATCCCCTAGGGCCTAGGATCC G+Bam HGGATCCCCTAGGGCCTAGGATCC G+B

19、st same cut position 29307) Isocaudamer BamH 5-G GATC C -3 Bcl 5-T GATC A-3 3-C CTAG G -5 5-A CTAG T-3 Hybrid site： 5-T GATC C-3 （BamH） （Bcl） 3-A CTAG G-5 Reaction system：enzyme, substrate, buffer1U：in most appropriate reaction conditions, 60 min, 1g DNA 31Activity factor: temperature, buffer, time,

20、 reaction volume, Glycerol concentration, DNA purity and structureeg：4 g DNA /1U Hpa 50 l 37 15 h 1 g DNA /1U Hpa 50 l 37 1 h Reaction conditions of restriction enzymes IIMechanism of DNA LigaseCharacteristic and application of DNA Ligase323. DNA LigaseDNA ligase: E.coli and T4 phage can encode an e

21、nzyme, which seals single-stranded nicks between adjacent nucleotides in a duplex DNA chain. 33341) Mechanism of DNA ligaseCharacteristic of DNA ligase(1) 5 G-C-T-C-T-G-C-A G-G-A-G 3 3 C-G-A-G A-C-G-T-C-C-T-C 5OHPPOH5 G-C-T-C-T-G-C-A-G-G-A-G 33 C-G-A-G-A-C-G-T-C-C-T-C 5DNA Ligasenicknick35(2)nick5 G

22、-C-U-C-U-G-C-C-G-G-A-G 33 C-G-A G-A-C-G-G-C-C-T-C 5OHP5 G-C-U-C-U-G-C-C-G-G-A-G 33 C-G-A-G-A-C-G-G-C-C-T- C 5DNA Ligase36(3)5 G-C-T-C-A-G-OH P-C-T-G-G-A-G 33 C-G-A-G-T-C-P OH-G-A-C-C-T-C 5 5 G-C-T-C-A-G-C-T-G-G-A-G 33 C-G-A-G-T-C-G-A-C-C-T-C 5DNA Ligase37T4DNA Ligase T4 DNA LigaseATPCohesive end & B

23、lunt endE.coli DNA LigaseDNA Ligase NAD+ Cohesive end 38Type of DNA Ligase3940the optimum temperature: 370C but at this temperature the hydrogen-bonded join between the sticky ends is unstable, so the temperature is a compromise between the enzyme action and association of the termini, the optimum t

24、emperature is 160C.412) Characteristic and application of DNA ligaseAmount of T4 DNA Ligase：Blunt end: 12 UCohesive end: 0.1 U ATP: 10 mol1 mmol/LThe ratio of exogenous and vector:10204243PCRRT-PCREnd modification44EnzymesDouble LinkerAdaptorsHomopolymer tailing454. End Modification46 EnzymesS1 Nucl

25、easeAlkaline PhosphatasePolynucleotide Kinase Single strand-specificEndonucleaseCohesive end into Blunt endMung Bean NucleaseKlenow FragmentLarge Fragment E. Coli DNA Polymerase IT4 DNA Polymerase47S1 NucleaseALP（ Prevent self-cyclization） CIP: from Calf thymusBAP: from E. coli5 p3 HOOH 3p 5 DNA or

26、RNAOH 3OH 5 5 HO 3 HOBAP / CIP48Alkaline PhosphatasePNKaseALPase 5 HO A T T A G C C C G OH 3 3 HO T A A T C G G G C OH 5Polynucleotide kinaseAlkaline phosphatase 5 p A T T A G C C C G OH 33 HO T A A T C G G G C p 549Polynucleotide Kinase50（1）To prevent recircularization of vector; （2）The direction of ligation is fixed;（3）It is favoured to put the cDNA fragment under the control of promoter by using Double-Linker ra