医用分子遗传学 -转录与转录后修饰ppt课件

1、李李 希希分子医学教育部重点实验室分子医学教育部重点实验室Transcription and Post-transcription Modification Post-transcriptional Processing of RNAMaking ends of RNARNA splicingPrimary Transcript Primary Transcript-the initial molecule of RNA produced- hnRNA （heterogenous nuclear RNA ） In prokaryotes, DNA RNA protein

2、 in cytoplasm concurrently In eukaryotes nuclear RNA Cp RNA Processing of eukaryotic pre-mRNAHuman dystrophin gene has 79 exons, spans over 2,300-Kb and requires over 16 hours to be transcribed! For primary transcripts containing multiple exons and introns, splicing occurs before transcription of th

3、e gene is complete-co-transcriptional splicing.Types of RNA processingA) Cutting and trimming to generate ends:rRNA, tRNA and mRNAB) Covalent modification:Add a cap and a polyA tail to mRNAAdd a methyl group to 2-OH of ribose in mRNA and rRNAExtensive changes of bases in tRNAC) Splicingpre-rRNA, pre

4、-mRNA, pre-tRNA by different mechanisms.The RNA Pol II CTD is required for the coupling of transcription with mRNA capping, polyadenylation and splicing The coupling allows the processing factors to present at high local concentrations when splice sites and poly(A) signals are transcribed by Pol II,

5、 enhancing the rate and specificity of RNA processing.The association of splicing factors with phosphorylated CTD also stimulates Pol II elongation. Thus, a pre-mRNA is not synthesized unless the machinery for processing it is properly positioned. Time course of RNA processing 5 and 3 ends of eukary

6、otic mRNAAdd a GMPMethylate it and1st few nucleotidesCut the pre-mRNAand add As5-UTR3-UTRCapping of pre-mRNAs Cap=modified guanine nucleotide Capping= first mRNA processing event - occurs during transcription CTD recruits capping enzyme as soon as it is phosphorylated Pre-mRNA modified with 7-methyl

7、-guanosine triphosphate (cap) when RNA is only 25-30 bp long Cap structure is recognized by CBCcap-binding complex） stablize the transcript prevent degradation by exonucleases stimulate splicing and processingSometimesmethylatedSometimesmethylated The cap is added after the nascent RNA molecules pro

8、duced by RNA polymerase II reach a length of 25-30 nucleotides. Guanylyltransferase is recruited and activated through binding to the Ser5-phosphorylated Pol II CTD. The methyl groups are derived from S-adenosylmethionine. Capping helps stabilize mRNA and enhances translation, splicing and export in

9、to the cytoplasm.Capping of the 5 end of nascent RNA transcripts with m7GExisting in a single complexConsensus sequence for 3 processAAUAAA: CstF (cleavage stimulation factor F)GU-rich sequence: CPSF (cleavage and polyadenylation specificity factor)Polyadenylation of mRNA at the 3 endCPSF: cleavage

10、and polyadenylation specificity factor.CStF: cleavage stimulatory factor.CFI & CFII: cleavage factor I & II.PAP: poly(A) polymerase.PABPII: poly(A)-binding protein II.Poly(A) tail stabilizes mRNA and enhances translation and export into the cytoplasm.RNA is cleaved 1035-nt 3 to A2UA3.The bin

11、ding of PAP prior to cleavage ensures that the free 3 end generated is rapidly polyadenylated.PAP adds the first 12A residues to 3-OH slowly.Binding of PABPII to the initial short poly(A) tail accelerates polyadenylation by PAP.The polyadenylation complex is associated with the CTD of Pol II followi

12、ng initiation.Functions of 5 cap and 3 polyA Need 5 cap for efficient translation: Eukaryotic translation initiation factor 4 (eIF4) recognizes and binds to the cap as part of initiation. Both cap and polyA contribute to stability of mRNA: Most mRNAs without a cap or polyA are degraded rapidly. Shor

13、tening of the polyA tail and decapping are part of one pathway for RNA degradation in yeast.mRNA Half-life t seconds if seldom needed t several cell generations (i.e. 48-72 h) for houskeeping gene avg 3 h in eukaryotes avg 1.5 min in bacteria Poly(A)+ RNA can be separated from other RNAs by fraction

14、ation on Sepharose-oligo(dT). Split gene and mRNA splicing Background: Adenovirus has a DNA genome andmakes many mRNAs. Can we determine whichpart of the genome encodes for each mRNA bymaking a DNA:RNA hybrid?Experiment: Isolate Adenovirus genomic DNA, isolate one adenovirus mRNA, hybridize and then

15、 look by EM at where the RNA hybridizes (binds) to the genomic DNA.Surprise: The RNA is generated from 4 different regions of the DNA! How can weexplain this? Splicing! The discovery of split genes (1977)1993 Noble Prize in Medicine To Dr. Richard Robert and Dr. Phillip SharpThe matured mRNAs are mu

16、ch shorter than the DNA templates. DNAmRNAExon and Intron Exon is any segment of an interrupted gene that is represented in the mature RNA product. Intron is a segment of DNA that is transcribed, but removed from within the transcript by splicing together the sequences (exons) on either side of it.E

17、xons aresimilar in sizeIntrons are highlyvariable in sizeGT-AG rule GT-AG rule describes the presence of these constant dinucleotides at the first two and last two positions of introns of nuclear genes. Splice sites are the sequences immediately surrounding the exon-intron boundaries Splicing juncti

18、ons are recognized only in the correct pairwise combinationsThe sequence of steps in the production of mature eukaryotic mRNA as shown for the chicken ovalbumin gene.The consensus sequence at the exonintron junctions of vertebrate pre-mRNAs.4 major types of introns 4 classes of introns can be distin

19、guished on the basis of their mechanism of splicing and/or characterisitic sequences:Group I introns in fungal mitochondria, plastids, and in pre-rRNA in Tetrahymena (self-splicing)Group II introns in fungal mitochondria and plastids (self-splicing)Introns in pre-mRNA (spliceosome mediated) Introns

20、in pre-tRNAGroup I and II intronsThe sequence of transesterification reactions that splice together the exons of eukaryotic pre-mRNAs.Splicing of Group I and II introns Introns in fungal mitochondria, plastids, Tetrahymena pre-rRNA Group I Self-splicing Initiate splicing with a G nucleotide Uses a p

21、hosphoester transfer mechanism Does not require ATP hydrolysis. Group II self-splicing Initiate splicing with an internal A Uses a phosphoester transfer mechanism Does not require ATP hydrolysisSelf-splicing in pre-rRNA in Tetrahymena : T. Cech et al. 1981Exon 1Exon 2Intron 1Exon 1 Exon 2Intron 1+pr

22、e-rRNASpliced exonIntron circleIntron linearpre-rRNANuclear extractGTP+-+-+-+-Products of splicing were resolved by gel electrophoresis:Additional proteinsare NOT needed forsplicing of this pre-rRNA!Do need a G nucleotide (GMP, GDP, GTP or Guanosine).The sequence of reactions in the self-splicing of

23、 Tetrahymena group I intron.Where is the catalytic activity in RNase P?RNase P is composed of a 375 nucleotide RNA and a 20 kDa protein. The protein component will NOT catalyze cleavage on its own.The RNA WILL catalyze cleavage by itself !The protein component aids in the reaction but is not require

24、d for catalysis.Thus RNA can be an enzyme.Enzymes composed of RNA are called ribozymes.Hammerhead ribozymes A 58 nt structure is used in self-cleavage The sequence CUGA adjacent to stem-loops is sufficient for cleavage CUGAGACCGGGGCCAAAACUC GAGUCACCACUGGUGUBond that is cleaved.53CUGA is required for

25、 catalysisMechanism of hammerhead ribozyme The folded RNA forms an active site for binding a metal hydroxide Attracts a proton from the 2 OH of the nucleotide at the cleavage site. This is now a nucleophile for attack on the 3 phosphate and cleavage of the phosphodiester bond.1989 Nobel Prize in che

26、mistry, Sidney Altman, and Thomas Cech Distribution of Group I introns Prokaryotes eubacteria (tRNA & rRNA), phage Eukaryotes lower (algae, protists, & fungi) nuclear rRNA genes, organellar genes, Chlorella viruses higher plants: organellar genes lower animals (Anthozoans): mitochondrial 180

27、0 known, classified into 12 subgroups, based on secondary structureSplicing of pre-mRNA The introns begin and end with almost invariant sequences: 5 GUAG 3 Use ATP hydrolysis to assemble a large spliceosome (45S particle, 5 snRNAs and 65 proteins, same size and complexity as ribosome) Mechanism is s

28、imilar to that of the Group II fungal introns: Initiate splicing with an internal A Uses a phosphoester transfer mechanism for splicingInitiation of phosphoester transfers in pre-mRNAUses 2 OH of an A internal to the intronForms a branch point by attacking the 5 phosphate on the first nucleotide of

29、the intronForms a lariat structure in the intronExons are joined and intron is excised as a lariatA debranching enzyme cleaves the lariat at the branch to generate a linear intronLinear intron is degradedInvolvement of snRNAs and snRNPs snRNAs = small nuclear RNAs snRNPs = small nuclear ribonucleopr

30、oteins particles (snRNA complex with protein) Addition of these antibodies to an in vitro pre-mRNA splicing reaction blocked splicing. Thus the snRNPs were implicated in splicing Recognizing the 5 splice site and the branch site. Bringing those sites together. Catalyzing (or helping to catalyze) the

31、 RNA cleavage.Role of snRNPs in RNA splicingRNA-RNA, RNA-protein and protein-protein interactions are all important during splicingsnRNPs U1, U2, U4/U6, and U5 snRNPsHave snRNA in each: U1, U2, U4/U6, U5Conserved from yeast to humanAssemble into spliceosomeCatalyze splicingSplicing of pre-mRNA occur

32、s in a “spliceosome” an RNA-protein complexpre-mRNAspliced mRNAspliceosome(100 proteins + 5 small RNAs)The spliceosome is a large protein-RNA complex in which splicing of pre-mRNAs occurs.Assembly of spliceosome snRNPs are assembled progressively into the spliceosome. U1 snRNP binds (and base pairs)

33、 to the 5 splice site BBP (branch-point binding protein) binds to the branch site U2 snRNP binds (and base pairs) to the branch point, BBP dissociates U4U5U6 snRNP binds, and U1 snRNP dissociates U4 snRNP dissociates Assembly requires ATP hydrolysis Assembly is aided by various auxiliary factors and

34、 splicing factors.Some RNA-RNA hybrids formed during the splicing reactionSteps of the spliceosome-mediated splicing reactionA schematic diagram of six rearrangements that the spliceosome undergoes in mediating the first transesterification reaction in pre-mRNA splicing.Assembly of spliceosomeThe sp

35、liceosome cycleThe Significance of Gene Splicing The introns are rare in prokaryotic structural genes The introns are uncommon in lower eukaryote (yeast), 239 introns in 6000 genes, only one intron / polypeptide The introns are abundant in higher eukaryotes (lacking introns are histons and interfero

36、ns) Unexpressed sequences constitute 80% of a typical vertebrate structural gene Errors produced by mistakes in splice-site selectionMechanisms prevent splicing error Co-transcriptional loading process SR proteins recruit spliceosome components to the 5 and 3 splice sites SR protein = Serine Arginin

37、e rich protein ESE = exonic splicing enhancers SR protein regulates alternative splicingAlternative splicing Alternative splicing occurs in all metazoa and is especially prevalent in vertebrateFive ways to splice an RNARegulated alternative splicingDifferent signals in the pre-mRNA and different pro

38、teins cause spliceosomes to form in particular positions to give alternative splicing76575657Fas pre-mRNAAPOPTOSISAlternative splicing can generate mRNAs encoding proteins with different, even opposite functions(programmedcell death)Fas ligandSoluble Fas(membrane)FasFas ligand(membrane-associated)(+

39、)(-) Alternative possibilities for 4 exons leave a total number of possible mRNA variations at 38,016. The protein variants are important for wiring of the nervous system and for immune response.Drosophila Dscam gene contains thousands of possible splice variantsCis- and Trans-SplicingCis-: Splicing

40、 in single RNATrans-: Splicing in two different RNAs Y-shaped excised introns (cis-: lariat) Occur in C. elegance and higher eukaryotes but it does in only a few mRNAs and at a very low level pre-mRNA splicingtrans-mRNA splicingspliced leaderSame splicing mechanism is employed in trans-splicingSplic

41、ed leader contains the cap structure!RNA editing RNA editing is the process of changing the sequence of RNA after transcription. In some RNAs, as much as 55% of the nucleotide sequence is not encoded in the (primary) gene, but is added after transcription. Examples: mitochondrial genes in Trypanosom

42、es （锥虫） Can add, delete or change nucleotides by editingTwo mechanisms mediate editing Guide RNA-directed uridine insertion or deletion Site-specific deaminationInsertion and deletion of nucleotides by editing Uses a guide RNA (in 20S RNP = editosome) that is encoded elsewhere in the genome Part of

43、the guide RNA is complementary to the mRNA in vicinity of editing Trypanosomal RNA editing pathways.(a) Insertion. (b) Deletion. Mammalian example of editingThe C is converted to U in intestine by a specific deaminating enzyme, not by a guide RNA.Cutting and Trimming RNA Can use endonucleases to cut

44、 at specific sites within a longer precursor RNA Can use exonucleases to trim back from the new ends to make the mature product This general process is seen in prokaryotes and eukaryotes for all types of RNAThe posttranscriptional processing of E. coli rRNA.RNase III cuts in stems of stem-loops16S r

45、RNA23S rRNARNase IIINo apparent primary sequence specificity - perhaps RNase III recognizes a particular stem structure.Eukaryotic rRNA Processing The primary rRNA transcript (7500nt, 45S RNA) contains 18S, 5.8S and 28S Methylationoccur mostly in rRNA sequence80%: O2-methylribose, 20%: bases (A or G

46、) peudouridine 95 U in rRNA in human are converted to Ysmay contribute rRNA tertiary stabilityTransfer RNA Processing Cloverleaf structure CCA: amino acid binding site Anticodon 60 tRNA genes in E. coliA schematic diagram of the tRNA cloverleaf secondary structure.Endo- and exonucleases to generate

47、ends of tRNAEndonuclease RNase P cleaves to generate the 5 end.Endonuclease RNase F cleaves 3 nucleotides past the mature 3 end.Exonuclease RNase D trims 3 to 5, leaving the mature 3 end.Splicing of pre-tRNA Introns in pre-tRNA are very short (about 10-20 nucleotides) Have no consensus sequences Are

48、 removed by a series of enzymatic steps: Cleavage by an endonuclease Phosphodiesterase to open a cyclic intermediate and provide a 3OH Activation of one end by a kinase (with ATP hydrolysis) Ligation of the ends (with ATP hydrolysis) Phosphatase to remove the extra phosphate on the 2OH (remaining af

49、ter phosphodiesterase )Steps in splicing of pre-tRNAPOH 52,3 cyclic phosphateExcised intronIntron of 10-20 nucleotides1. Endo-nuclease2. Phospho-diesterase3. Kinase (ATP)4. Ligase (ATP)5. Phosphatase+Spliced tRNACCA at 3 end of tRNAs All tRNAs end in the sequence CCA. Amino acids are added to the CC

50、A end during “charging” of tRNAs for translation. For most eukaryotic tRNAs, the CCA is added after transcription, in a reaction catalyzed by tRNA nucleotidyl transferase.All of the four bases in tRNA can be modified Pathologies resulting from aberrant splicing can be grouped in two major categories

51、 Mutations affecting proteins that are involved in splicingExamples:Spinal Muscular AtrophyRetinitis PigmentosaMyotonic Dystrophy Mutations affecting a specific messenger RNA and disturbing its normal splicing patternExamples:-ThalassemiaDuchenne Muscular DystrophyCystic FibrosisFrasier SyndromeFron

52、totemporal Dement i a and ParkinsonismIntron Advantage? One benefit of genes with introns is a phenomenon called alternative splicing A pre-mRNA with multiple introns can be spliced in different ways This will generate mature mRNAs with different combinations of exons This variation in splicing can occur in different cell types or during different stages of developmentIntron Advantage? The biological advantage of alternative splicing is that two (or more) polypeptides can be derived from