分子遗传学：Protein Synthesis

1、Protein Synthesis(Translation),Textbook,DNA,RNA,Protein,Central Dogma,1968 Robert W. Holley, Har Bobind Khorana, Marshall W. Nirenberg “For their interparetation of the genetic code and its function in protein synthesis”,UCUCUCU UCU CUC UCU,UCU-Serine CUC-Leucine,The 2009 chemistry Nobel Prize has b

2、een awarded to Venkatraman Ramakrishnan, Thomas Steitz and Ada Yonath,N AT U R E | VO L 4 9 7 | 2 MAY 2 0 1 3,PART I: Protein Synthesis Components PART II: Protein Synthesis Process PART III: Protein Synthesis Regulation PART IV: Posttranslational Processing and Targeting PART V: Protein Synthesis i

3、n Medicine,PART I: Protein Synthesis Components,The components of translation 1. mRNAs (the genetic code) 2. Aminoacylated tRNAs 3. Ribosomes 4. Protein factors (and energy),Prokaryote: polycistron,Eukaryote: monocistron,Untranslated Region,Ribosome binding site,Initiation codon,Termination codon,Co

4、ding region,3,Protein,5,Cap structure,1. mRNAs (the genetic code),Eukaryotic mRNAs have same general features as bacterial mRNAs but . 1. Special “cap” with a 5-5 linkage between a modified guanosine nucleotide and the first nucleotide of the transcript (post-transcriptional) 2. poly(A) tail - 50 to

5、 200 adenosines (post-transcriptional),7-methylguanylate cap,What is the relationship between mRNA and the amino acid sequences?,RNA A/C/U/G,Protein 20 Amino acids,?,The math: 4 x 4 = 16 4 x 4 x 4 = 64 4 x 4 x 4 x4 = 256 .,The Genetic Code,What do we need in a code? starts stops all triplets code fo

6、r something nice to have single nt changes be rather conservative,-the substrates of translation represent the process of translation - phenotype at one end (CCA) and genotype at the other (anticodon) -the acceptor end carries a universally conserved CCA sequence that is essential for interactions w

7、ith elongation factor EF-Tu and the ribosomal tRNA binding sites (A, P and E); the appropriate amino acid is attached by the aminoacyl tRNA synthetase; this end of the tRNA interacts with the large subunit (50S) of the ribosome where peptide bond formation occurs -the anticodon end of the tRNA is re

8、sponsible for the codon:anticodon interaction that results in high fidelity protein synthesis; this interaction takes place on the small subunit (30S/40S) of the ribosome,Features of the Genetic Code,A. Colinear,The sequence of codons is read from 5 to 3 Polypeptide from amino end to carboxyl end,mR

9、NA,Polypeptide,The genetic codons should be read continuously without spacing or overlapping.,B. Commaless,spacing,overlapping,If there are insertion or deletion of one or two nucleotide(s) in the coding region of mRNA, frameshift mutations occur.,C. Degenerate,目 录,Multiple codons may decode the sam

10、e amino acid Most amino acids have more than one codons except Met and Trp,degeneracy,目 录,Amino acid,Amino acid,Codon number,Codon number,D. Universal The genetic codons are largely universal except for the mitochondria,Cytoplasm AUA: Ile AUG: Met, initiation UAA, UAG, UGA: termination,Mitochondria

11、AUA: Met, initiation UGA: Trp AGA, AGG: termination,E. Wobble Non-Watson-Crick base pairing is permissible between the third nucleotide of the codon on mRNA and the first nucleotide of the anti-codon on tRNA.,How does wobble pairing allow for the degeneracy of the code?,So, if perfect matches betwee

12、n the anticodon and codon were required, then there would be 61 tRNAs in each organism but there are usually 30-40 tRNA species,-so, every codon in the mRNA corresponds to a specific amino acid but some anticodons can read multiple codons,Base-pair of codon and anticodon,First step in decoding is to

13、 get the right amino acid on the right tRNA (this is fundamentally the deciphering of the code) -ca. 20 synthetases (for 20 amino acids) (RS) Two-step mechanism: Activation step: RS + aa + ATP - RS (aa-AMP) + PPi Transfer step: RS (aa-AMP) + tRNA - RS + AMP + aa-tRNA Pyrophosphate hydrolysis: PPi +

14、H2O - 2Pi - aa + ATP +tRNA +H2O - aa-tRNA + AMP + 2Pi,2. Aminoacylated tRNAs,1st step:,Amino acidATP-E aminoacyl-AMP-E PPi,目 录,Amino acid,Aminoacyl-AMP,A,A,Carboxly,Phosphate,2nd step:,aminoacyl-AMP-E tRNA aminoacyl-tRNA AMP E,目 录,A,A,A,Aminoacyl-AMP,aminoacyl-tRNA synthetase,Aminoacyl-tRNA （AA-tRNA

15、）,Aminoacyl-tRNA synthetases catlyze specific amino acids and tRNAs (20 types). aminoacyl-tRNA synthetase has proof-reading activity (editing activity) ; error rate 1/40,000 aminoacyl-tRNA (AA-tRNA)： Lys-tRNALys Met-tRNAMet,Active form aminoacyltRNA Activation site a - carboxyl group Linkage ester b

16、ond Activation energy 2 high-energy bonds,Summary of AA activation,How do the synthetases achieve high levels of fidelity? -how are very similar overall tRNAs distinguished,What about amino acids? -large amino acids are readily excluded from binding pockets (e.g. tryptophan excluded from alanineRS)

17、-but there is also a hydrolytic site (“proofreading”) on the enzyme where inappropriately charged tRNAs are selectively deacylated (pocket not filled and external water can come in) (e.g. glycine gets loaded by alanineRS),Charging tRNA: amino acid + ATP aminoacyl-AMP + Ppi aminoacyl-AMP + tRNA amino

18、acyl-tRNA + AMP N-acetylation of aminoacyl-tRNA: Acetic anhydride used to acetylate aminoacyl-tRNA,3. The ribosome -the mass of the bacterial ribosome is ca. 2.5 million daltons and its dimensions are about 200 per side (compared to tRNA at ca. 60 lengths) -two subunits perform two basic functions o

19、f translation - how are these activities integrated across the subunit interface,Three important sites on ribosomes,Ribosomes (the translation machine) -more than 80% of cellular RNA; sediment at “70S” in sucrose gradient; two-thirds of the mass of a ribosome is RNA and its sequence is highly conser

20、ved (drug target) -all ribosomes are composed of two subunits; a large subunit and a small subunit that interact with the acceptor and anticodon end of the tRNA, respectively,Structure of 40s and 60s ribosomal subunits,Ternary complex,Structure of 80s,Location of initiation complex on ribsome,Struct

21、ures of translation related components in database,-ribosome conservation is remarkable; there are reports of functional interactions (i.e. translation) between the small subunit of a eukaryote Artemia salina (sea monkeys) and the large subunit of the eubacteria E. coli -certain regions of the rRNA

22、are universally conserved across all three phylogenetic kingdoms including the sarcin-ricin loop of 23S rRNA,the P and A loops of 23S rRNA, the central PT loop of 23S rRNA, the 530 loop and the decoding region of 16S rRNA - not surprisingly these are all regions that are fundamental to the various f

23、unctions of the ribosome,Ribosome conservation,Another “component” of translation the protein factors -a number of protein factors are involved in all steps of protein synthesis IFs are involved in initiation EFs are involved in elongation RFs are involved in termination,BacterialEukaryotic Initiati

24、onIF1eIF1A IF2eIF5B IF3eIF1 (fidelity of AUG) eIF2 (tRNAMet) eIF4E (cap) eIF4G (scaffold) eIF4A (helicase) eIF4B (RNA binding) eIF3 (unknown/ large) eIF5 (GAP for eIF2) PABP ElongationEF-TueEF-1a EF-GeEF2 EF-TseEF-1b TerminationRF1eRF1 (Release)RF2 RF3eRF3 RecyclingRRF?,Eukaryotic core initiation fa

25、ctors,Current Opinion in Structural Biology 2012, 22:768777,PART II: Protein Synthesis Process,The translational cycle,1. Initiation 2. Elongation 3. Termination,2.1 Formation of Initiation Complex,In the initiation stage, ribosome, initiation aminoacyl-tRNA and mRNA molecules are assembled to the t

26、ranslational initiation complex,For prokaryotes: fMet-tRNAimet can only be recognized by initiation codon. Met-tRNAemet is used for elongation. For eukaryotes: Met-tRNAmet is used for both initiation and elongation.,Initiation tRNA,Prokaryotic Met-tRNAmet can be formylated to fMet-tRNAimet.,Prokaryo

27、tic Met-tRNAmet,Met-tRNAmet + N10-formyl tetrahydrofolate (四氢叶酸),fMet-tRNAimet + tetrahydrofolate,formyl Transferase 甲酰转移酶,Translational initiation factors in prokaryote,IF-3 is needed for 30S subunits to bind specifically to initiation sites in mRNA. IF-2 binds a special initiator tRNA and controls

28、 its entry into the ribosome. IF-1 binds to 30S subunits only as a part of the complete initiation complex, and could be involved in stabilizing it, rather than in recognizing any specific component.,The forming of translational initiation complex in prokaryote,Initiation factors IF-1 and IF-3 bind

29、to the free 30s subunit ； mRNA bind to ribosome 30s subunit； With the help of IF-2 and GTP, the initiator fMet- tRNA can bind to the initiation codon ( AUG ) on the mRNA； The 50S subunit binds, displacing IF1, IF2 and IF3. The 70S initiation complex is formed.,Initiation (in eukaryotes) - cap and po

30、lyA tail are critical for message quality control and translation regulation How to get the 40S subunit on the mRNA with the Met-tRNAi engaged in the P site with the AUG start site - i.e. the same problem -a complex of proteins assembles at the cap structure, these proteins then interact with the po

31、lyA tail (and associated PABP) to form the closed loop complex ready for translation General observation: synergistic effects on translation by the 5 cap and 3 polyA structures - disruption of the 4G-4E or the 4G-PAB interactions substantially diminish translation,eIF4 Factors Are Required for Cap-d

32、ependent Translation Initiation,eIF4E,eIF4G,eIF4A,eIF4B,eIF3,40S,m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC,AAAAAAAAA,Wells et al. Mol. Cell 2, 135-40. Circularization of mRNA by Eukaryotic Translation Initiation Factors.,Atomic force microscopy,2.2 Translation Initiation,Prokaryotics Eukaryotics,IF-3,IF

33、-1,IF-1 and IF-3 bind to a free 30S subunit,目 录,This helps to prevent a large subunit binding to it without an mRNA and forming an inactive ribosome.,Translation initiation in Prokaryotics,IF-3,IF-1,mRNA binds to 30S subunit,目 录,S-D sequence（Shine-Dalgarno sequence）,also called（ribosomal binding sit

34、e, RBS）,8-13 nt upstream of the initiation codon in prokaryotic mRNA which base-pairs with a complementary sequence near the 3 end of 16SrRNA. That results in the initiation codon in the P site.,S-D sequence rpS-1 recognizing sequence,16S-rRNA in ribosome small unit,IF-3,IF-1,fMet-tRNA bind to the i

35、nitiation codon of mRNA,目 录,IF-3,IF-1,IF-2,GTP,50S ribosomal subunit incorporate into complex,目 录,Translation initiation in Eukaryotics,eIF4E,eIF4G,eIF4A,eIF4B,eIF3,40S,m7GpppGAUUCGAUACCAGGGAGCUUGGCACCAUGGC,AAAAAAAAA,Activation of mRNA,Eukaryotic Translation Initiation,IRES Driven Translation Initia

36、tion,IRES: Internal ribosome entry site,Existed in: virus (EMCV:脑心肌炎；HCV：丙肝病毒； CrPV:蟋蟀麻痹病毒） some cellular mRNA (c-Myc; p53; XIAP),eIF4 Factors Are Not Required for HCV IRES Translation Initiation,eIF3,40S,PABP,PABP,AAAAAAAAA,2.3 Elongation,Three steps in each cycle: Positioning an aminoacyl-tRNA (AA

37、-tRNA) in the A site- Entrance Forming a peptide bond-Peptide bond formation Translocating the ribosome to the next codon-Translocation,Elongation is a process of repeated ribosomal cycles of amino acid addition. Polypeptides grow stepwise from the amino terminus to the carboxyl terminus.,Elongation

38、 factors (EFs) are required,Prokaryote：EF-Tu, EF-Ts and EF-G Eukaryote： eEF-1 , eEF-1 and EF-2,Step 1: Entrance,An AA-tRNA occupies the empty A site. Registration of the AA-tRNA consume one GTP. The entrance of AA-tRNA needs to activate EF-T.,Tu,Ts,GTP,GDP,Tu,Ts,Step 2: Peptide bond formation,The pe

39、ptide bond formation occurs at the A site. The formylmethionyl group is transferred to NH2 of the AA-tRNA at the A site by a peptidyl transferase The 23SrRNA ( in eukaryotic ribosome the 28SrRNA ) catalyzes the peptide bond formation: ribozyme,Peptide bond formation 1,Peptide bond formation 2,Step 3

40、: Translocation,EF-G is a translocase. GTP bound EF-G provides the energy to move the ribosome one codon toward the 3 end on mRNA. After the translocation, the uncharged tRNA is released from the E site.,Translocation,fMet,fMet,Intermediates of the small subunit during mRNA and tRNA translocation,De

41、coding center of eubacterial 70s ribosome,Eukaryotic Elongation,eEF1A mediated tRNA binding,eEF2 mediated translocation,Step 1. Loading tRNA and Coden Recognition by eEF1,Step 2. Peptidyl Transfer,Step 3. Translocation by eEF2,eEF1A, eEF2, GTP, ribosomes, polyU RNA, tRNA-Phe,2.4 Termination,Release factors Prokaryotes RF-1 recognizes the termination codons UAA and UAG RF-2 recogn